EST details — SGN-E421487

Search information 
Request: 421487Match: SGN-E421487
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273642Clone name: STM-32-P18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273642 [STM-32-P18] Trace: SGN-T273625 EST: SGN-E421488 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421487Length: 583 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E421487 [] (trimmed) CTTCCCGATTTACCCCTCATCAAATCGACGATTCGTTCTGCGAAGCGGTCGGGTCCGGTTTAACCGGCGTTATTTTCCTCGCCGATCAGCTTAAT
CTGAACCGTTTGTTATCTTATCATCATCAACAGCAAAATGATGAAAAAACCGGTGCCGATTCAAGTACCTGTGTGGTTTGCTTGAACCGGTTGGG
TGATGGTGACCGGGTGCGCAAGTTAGCATGCCGGCACGTGTTTCACACGGAGTGTTTAGATGGGTGGTTCAATACGCTAAATTTCAACTGTCCAC
TTTGCCGGTCGACTTCGGTCTCCGGTGAGCGCGTGGTGAGAGCGCGGCGGCGCGTTGCTGGGGATTTACTTGCTTGGTTCTCGTTAAACTGAGTG
TTAATGGTCGACGATGAAAATTAGACTTTTTTTCTTTCTTTTTTTATTTTTCTTTTCACTTTTGTGGGATTACTTTTAGTTTTTTTTTTTTTAGG
AAATTAATATTTTTTTCCTTTTTGTTTTGTTTTTGAAGGGCATTGATAAGAAGCTCTTTTGTAGCACTTGATAATGATGTAAAAAGGTTTTTGTT
TTTGTTAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421487] SGN-U277004 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273624 [Download] [View] Facility Assigned ID: STMEX93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0112 Quality Trim Threshold: 12.5