EST details — SGN-E421548

Search information 
Request: 421548Match: SGN-E421548
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273797Clone name: STM-33-G3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421548Length: 515 bp (1048 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421548 [] (trimmed) TACAAACTTAAGATTGTGGGACACTCCTTGGGTGGAGGAACTGCAGCTATTTTAACTTATGTGCTTCGTGAGCAGAAGGAACTGTCAACAGCTAC
CTGTGTAGCATTTGCTCCAGCTGCCTGTATGACATGGGAATTAGCTGAATCGGGGTGTGAATTTATTACCTCGGTAATCAATGGAGCTGATTTGG
TCCCTACATTTTCAGCTGCTTCAGTGGACGATTTGCGTTCTGAGGTGACAACATCTGCTTGGTTGAACGATCTAAGAAATCAGATTGAGCATACT
AGGATTCTTAGTACTGTTTATCGTTCTGCATCAGCCCTGGGGTCTCGTCTTCCATCTATCGCCACTGCTAAAGCTAAGGTTGCAGGTGCTGGTGC
AATACTGCGGCCTGTTTCCAGTGGTACACAGGTTGTCATGAAGAGAGCGCAAAGTATGGCCCANGCAGCATTGTCACGACCTGCCATGCAACTGT
CATCATGGTCATGCATGGGTCCAAGACGTCGATCCACAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421548] SGN-U278042 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273685 [Download] [View] Facility Assigned ID: STMEY38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5