EST details — SGN-E421634

Search information 
Request: 421634Match: SGN-E421634
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273947Clone name: STM-33-O7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273947 [STM-33-O7] Trace: SGN-T273770 EST: SGN-E421633 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421634Length: 240 bp (913 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421634 [] (trimmed) ACTTTTTTTTTTTTTTCCAAGTTAATGTGTTTTTATGCAAATACGAGACAACTTTAGTAGTGACTTTATGTCTTTTCTCCTAGAAATATGATAAA
AGTTTGGTCATCTGTCATACAAAAGTTTGGTATTGAAAGCATTCATTCATCTACGAATGCAACCACAGACGGTCATGCAAGCGCTCGTCTCCTCC
ACCAAACATCTCATCAACCCTCTCACCATCTCTGTAGAAATGAAAAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421634] SGN-U274042 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273771 [Download] [View] Facility Assigned ID: STMEY88TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0048 Quality Trim Threshold: 12.5