EST details — SGN-E421634
| Search information |
| Request: 421634 | Match: SGN-E421634 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C273947 | Clone name: STM-33-O7 |
| ||
| Library Name: STM | Organism: Solanum tuberosum |
Tissue: mixed tissues
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C273947 [STM-33-O7] | Trace: SGN-T273770 | EST: SGN-E421633 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E421634 | Length: 240 bp (913 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E421634 [] (trimmed)
ACTTTTTTTTTTTTTTCCAAGTTAATGTGTTTTTATGCAAATACGAGACAACTTTAGTAGTGACTTTATGTCTTTTCTCCTAGAAATATGATAAA
AGTTTGGTCATCTGTCATACAAAAGTTTGGTATTGAAAGCATTCATTCATCTACGAATGCAACCACAGACGGTCATGCAAGCGCTCGTCTCCTCC
ACCAAACATCTCATCAACCCTCTCACCATCTCTGTAGAAATGAAAAGTTG
AGTTTGGTCATCTGTCATACAAAAGTTTGGTATTGAAAGCATTCATTCATCTACGAATGCAACCACAGACGGTCATGCAAGCGCTCGTCTCCTCC
ACCAAACATCTCATCAACCCTCTCACCATCTCTGTAGAAATGAAAAGTTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E421634] | SGN-U274042 | Solanum tuberosum | Build 4 | 7 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T273771 [Download] [View] | Facility Assigned ID: STMEY88TV |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.931 | Expected Error Rate: 0.0048 | Quality Trim Threshold: 12.5 |
Working
