EST details — SGN-E421742

Search information 
Request: 421742Match: SGN-E421742
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273836Clone name: STM-33-I22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421742Length: 575 bp (961 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E421742 [] (trimmed) GGCGACTGACCTTTCGTTTGTCAATGGAGTTCTTAGATGAAGACGCCAAACCCAGATTTCTCTTCCAATCAAAGCCACTACAGCAATCCAATTCC
GATCCGGAAACCCAAACCCGGTCTCTATACCGACCCGGAATCATCATCTCCATCTCTCTTTCTGTTCTTTTCTTTGCTCTTTCGATCCTCTATTT
CTCTTTTGAGCCCTTCGGATCCATCTTCTTATGGATCTCTCTTTCCCTCCTTGTCGGACCTTTTGCTCCTTCTTCCGTCACAGGTGGTGACATCC
GGGTCGGACTCGGAGAACCCATTCAAGACCCGCCTAAAGATGATCTTTCTGATACCGAACCCGATACGAAAAAATCAAACAGAAGATCTAACAGA
CCCACCAAGAAAAACGTTGACTTTGAGCCTGTGTTAGCTACCCATTATGATCTAAAGCCGGAGAAAACTAATGGGTCGGTGGCAAATTCGAAGAA
TAGTAATGGGTCGGTTGCGAATCTGGAGAAAAAAGTGGGGGATGGTGTGTGGAATGAAGGGGATGAGGAGTTGTTGAGGAAGATGATGGGGAAGC
ATCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421742] SGN-U276479 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273879 [Download] [View] Facility Assigned ID: STMEZ59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5