Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E421855

Search information 
Request: 421855Match: SGN-E421855
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273776Clone name: STM-33-F5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273776 [STM-33-F5] Trace: SGN-T273991 EST: SGN-E421854 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E421855Length: 471 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E421855 [] (trimmed) CACAACTTTTTTTATCGTGGAAACTTTGTTGACTTTATCATCAACCTTGATTTCGCTACGCTCAATAAGAAAGGTGAAAAGGAAATACAAATATT
ACATGTTAATGAATTCACTACTCCCCCTTTTATATACAACATAATGTAACAGTAGTAGTAGCAGGAAGAACTAGAAGTCAATAATTGGTTCACCA
ATAGTAAGATTCCTCTTGACAGACCAAGGTAAGTTAAAGAGCTTTGCCATTATGAACTTAAAGATCTTATTCACATTGATGTTATGCGTTGAACT
TGAGAAGAAAAGTGTTGCTTTCATTGCCTTTGCATATGTCCTTGCCTGTGTCACCACAGACCATTGAATGTCTGGTGGAAGCTGAACAAAATCAT
CAAATTTGGTCCCAATTAGTATTGGAATAGCAGTCTGATTCCACTTTCTTGCTTCAGTATACCAACTTATCACATTGTTCAATGTACTCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E421855] SGN-U279033 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T273992 [Download] [View] Facility Assigned ID: STMFA27TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0043 Quality Trim Threshold: 12.5