EST details — SGN-E422025

Search information 
Request: 422025Match: SGN-E422025
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273952Clone name: STM-33-P18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273952 [STM-33-P18] Trace: SGN-T274161 EST: SGN-E422024 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422025Length: 767 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422025 [] (trimmed) CAAACCTTTTTACACATACACACATCCAATAATGCCCACAAAAAGCTGTAATACAATATAAACTGTGATATACCAACAAAAAAGCACGCATATAT
ATAAGTTTAGACTACATTTTTCCCCAGTCACTACATAAGATAACATCACTTAAGCATAGCCTGGATTTTATTTTCCTTAAAACATTTGATCGTTT
TATTCATTCATGTGTTTGATCATGTAAACTTATAATTAGACATCAGTTGGAAGTTCCAACTTGGAATCGAAAGCCGGTTGATTTTCAAGATCACC
GTATGGACGTTGTCCTCTCCAGTTACCTGGTGGATCATAATTACAAGTTATAAAATACCACCCGTTGTTGCGCCTGACCCTAGCACAACCAAGAC
GTACCGAGTTACGCCACACCACCTGAGTATAGTGTCCACATACTTTACCCGCTTGACAAGTATTTGAATTATAATTGTACCATTGCTTCTCATCG
ACCCACATCTTCACAGCACCAGCCGCGTTGAGCTGGGGGAAAGCGGCAGCTAGGTTTTCACCGTAAGGGCCACCAGAGTGTTGCATCCTGCAGTC
CCCAATTCTTTGATTGGCATAATTTTGGGCAAAGGCTGCTAGCCTATTGTCCCATGTCATAGGACCGACACCAACTTGTCTACGAGCTGCATTGT
GAGGGGTAAGATATCTTGGGGGAGAGTTTTGAGCTTGTGATGAGTGAATATAGCAAAGATAAGGAACAAATGATTAAGGCNATATTGGAGTATCC
CATTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422025] SGN-U269642 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274162 [Download] [View] Facility Assigned ID: STMFB93TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0168 Quality Trim Threshold: 12.5