EST details — SGN-E422053

Search information 
Request: 422053Match: SGN-E422053
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C273977Clone name: STM-34-C5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C273977 [STM-34-C5] Trace: SGN-T274189 EST: SGN-E422052 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422053Length: 301 bp (897 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422053 [] (trimmed) TTACTCATCATGTATTGGTTTTGATAAATATTTGTCATATATCGTACTTTAAGTAGTTTTTTACCCAAATTATCAAAAGTCACAACATATTGAAG
TAGGAGTATGTACAAAATTAGGAAATTGCTGTCTCCTTTCATATATTGTTATTTGCCTATTATCCAAAGTCTCAAACAATCACACAACTATGTTT
GATTGTGCCGATACCATCATAAAATTTTGCATAGCTGGATTATTAGTACCCATCTGAATCTGGCCGTTATCGTTACTGGTTTTCTCCGCCTTCTT
TAATTCTTTAAGTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422053] SGN-U275445 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274190 [Download] [View] Facility Assigned ID: STMFC15TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0073 Quality Trim Threshold: 20.5