Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E422116

Search information 
Request: 422116Match: SGN-E422116
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274014Clone name: STM-34-K3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274014 [STM-34-K3] Trace: SGN-T274254 EST: SGN-E422117 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422116Length: 602 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E422116 [] (trimmed) CGAAGGCGTTTTACAGTATTTGAGTAAATCTGAATCTGCACAAGGAGCGATTCAACAGGGCGAGGAAATGGCGAGAAGAGCGGAAGAGGAGTACG
ATTACTTGTTCAAGGTTGTATTAATCGGCGATTCAGGAGTCGGCAAATCCAACTTGCTTTCCCGATTCACCAGAAATGAGTTTCTCTTAGAGTCC
AAATCCACTATCGGCGTTGAATTCGCCACTCGTACACTCCAGGTTGAGGGAAGGACCGTCAAGGCTCAGATCTGGGACACAGCTGGACAGGAGAG
ATACAGAGCCATTACAAGTGCTTACTATAGGGGTGCTCTTGGGGCTCTTCTGGTATATGATGTGACAAAACCCACTACCTTTGAGAATGTTAGTC
GGTGGTTGAAGGAACTGAGGGACCATGCAGATTCAAACATTGTGATTATGCTCATTGGAAACAAAACCGATCTGAAGCATCTCAGAGCAGTTGCT
ACTGAGGATGCTCAAAGCTTTGCTGAAAAAGAAGGCCTTTCTTTCATTGAAACATCTGCATTGGAGGCAACAAATGTAGAGAAGTCTTTCCAGAC
AATTCTTTCAGAAATCTATCCGATAATCAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422116] SGN-U271030 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274253 [Download] [View] Facility Assigned ID: STMFC62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5