EST details — SGN-E422631

Search information 
Request: 422631Match: SGN-E422631
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274062Clone name: STM-40-B8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422631Length: 340 bp (870 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E422631 [] (trimmed) TTTTTTTTTTTATTTTGCACAGGCGCAACTTATGAGGAAAATAGCTCTAGTCTGGCTATATAACATTAGCTAGCACAAGTACAAGAAACTAATGC
AGAATAATTCTAGTGAGTATTAGCTACAACTCTTCATACTCGATATCATAATATTGACACATTTGCATGCTAATGCAGGAACAGCATAGAAATCA
TTAAGGGTACAGCAAATCCAGAAAGTGCCAAAGCAGACAAGTCTCCACAATCCTTCAAATTTAATCAGCTCAATATTCAGAACCACGTTGACACA
AAGCGGAAACCATACTGGCACTTCATGGCTTCCAGCTAAACAACTGGCACATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422631] SGN-U271434 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274768 [Download] [View] Facility Assigned ID: STMGD04TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5