Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E422859

Search information 
Request: 422859Match: SGN-E422859
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274566Clone name: STM-41-I17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274566 [STM-41-I17] Trace: SGN-T274995 EST: SGN-E422858 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422859Length: 881 bp (1118 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422859 [] (trimmed) ACATTACATCTCTCACAAAACATAATGACAACTTTTGAATCAGGAATGTATCATCAACTAGTGAATGTCAATCCAAGTGGTATAAAAGCAAATCT
CCTACATACAAACAGCTAAACCTAGAAAAACAAGAAAAGTAGAAAGCCCTTGAGACTTTACAAGAACTGAATCAACAAATCCCTGAGAACTCAGA
TACATCGATGATGCTTAACTTACGAAGTAACTTCTGCCTTCCAAAAGAATCAAGACACGTTATTCGGGGCCTCCATAAGTATAGTACAAACTCAT
ATGCTCAAATGTTCATCTCTTGGCAAGCTTTGGACAGTATCTGACCATCTTCCTGGTGAATGGTCACTGCTATTGGAGGACCCTTGAGCTTCTGC
TCTAGCATCCCGGATCATCTTCAAAACATCCTTCATTGTGGGTCGATTCTCTGGTACAAGTGAAACACAAGCCATAGCTACGTTTAAGAGAGCAC
CGAGTTTCTCTTCCGAGGCTTCATTACTGGAAGCAGGTTCATCACCTGATTCAGTTTCTTCTTCTCGAACAGATTTCACCCACCTCGGTATGTCT
GATCCGTGTTCTTGAACAAGATCTTGAAATGGAGTCTTTCCCGTGAGGAGCTCCAATAGGAGGACACCAAAGCTATAGACATCGGCCTGAATGGG
TAAGTGGCCTTCGAATGTCACGACACTCAGGAGCTCTATAGAAGAGGGAAGAAGCACCTGATTCCTCAGGAGAATCTAGATTCCTAAATGGCATG
AGGCCATAATCTGTAAGACACGACTCAAAGTCGGCCCCCAAGAGTACATTTGATGATTTCAAGTTTCCATGAGTCAGACCAGGGTTCTGATGGAT
ATGAAGCAATCCAGTAGCCACATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422859] SGN-U280229 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T274996 [Download] [View] Facility Assigned ID: STMGE57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0057 Quality Trim Threshold: 20.5