EST details — SGN-E422875

Search information 
Request: 422875Match: SGN-E422875
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274612Clone name: STM-41-K15
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422875Length: 563 bp (954 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E422875 [] (trimmed) CAGCAAAAAGGCGAAAGATCAAAATTTGAGAAAAGCTATGAGTTCTTCTTTGTTCTGAATTCATCTTTAAGCCCTAAGGAGAAAAAAACTTCTTG
CAGAAAATGACCACACCATTGATAGCAGGACTGAGTGTTGCTGCTGCTGCATTGGCTGGAAGGTATGGCATCCAGGCTTGGCAAGCATTCAAGGC
CAGACCACCCACTGCAAGAATGCGAAAATTTTATGAAGGAGGTTTTCAGCCTAAAATGACGAGGAGGGAAGCAGCTCTTATTCTTGGAGTCAGGG
AAAGCACTCCAGCAGATAAAGTGAGGGAGGCACATAGGAAGGTGATGGTAGCCAACCATCCAGATGCAGGAGGCAGTCACTACCTTGCTTCAAAA
ATTAATGAAGCGAAAGACATAATGCTTGGGAAGTCTAAGAACAGCGGGTCTGCATTTTAATCTCAACCGAGAGTCTCTTTGGTGCTTTAGAAGTT
ACAAATTACATGGTAACCGGAGGCGGATCATGCTTTCTGGCATTATAGACAACTTTAAAGTGAAGTAGATTGATTCTTTTTGACCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422875] SGN-U276928 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275012 [Download] [View] Facility Assigned ID: STMGE68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5