EST details — SGN-E422887

Search information 
Request: 422887Match: SGN-E422887
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274671Clone name: STM-41-M9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274671 [STM-41-M9] Trace: SGN-T275023 EST: SGN-E422886 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E422887Length: 622 bp (1089 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E422887 [] (trimmed) TGCACAAACACAAAACACACAAAAAGAGGAAAATAGCATTCCCATATTTACATCATGAGAAAGGTAGGTAGATTTTGGGGCAAAAACATTGGTGT
ATCAACTATATGAGGGGGCTTGAGACCTAAACCAAAAAAAAAAAAAAAACACAAAAGTGGGGCACTTTTTGAAGAGTAAATGGTGCAAAACAAAA
AATGCAACCATGAAAAAAGTAACATTATCCCTATTTCTGTTTTACTTTTTGTTTCTTCCAAACTTTTTTTACCAAGCATGTTCCTTGCACCAAAG
CATATTTAGATAGGTTTTCCTTTGTGTCTCTCTTGTTTCTGAGGGATTCTTGGAGCAAGTCCATTAGCCTCAGAAGTCCTCATGATTCTTAGCCT
TTTCACAGTGTTGAGAAACATCCCAAATGGAACATCTCCAACAAGCATCCAGTCTCCTTCTTTATCCTCATATGTGAGCACAAATTCAGATGATC
CATCCAAGAGCTTAAAAGACTTAGTTGCTTGTTCCTTTTCACCGCTTTTGGTAGATTTGACGAACATATCCTCCAAGGTTTCGGCTAACGATTCA
TAGCAAGTATGAGCATTCAAATCCACCTTTCTTCCAATAGGCAAACCATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E422887] SGN-U281093 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275024 [Download] [View] Facility Assigned ID: STMGE77TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0079 Quality Trim Threshold: 20.5