EST details — SGN-E423020

Search information 
Request: 423020Match: SGN-E423020
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274607Clone name: STM-41-K10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274607 [STM-41-K10] Trace: SGN-T275158 EST: SGN-E423021 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423020Length: 701 bp (977 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E423020 [] (trimmed) CAAGAACCGACCCGTTAACCCGGAGGAATGACCCGTTAACCCACCGTAAAGTTAGCGTACCCGGATCCAAACCGGATTCTTCTTCAATGAAGGTT
GAGAAGCTGAAGGTGAAGGAAGCAAAGGAAAGGAAAGAGGAAACGAACAAAAAGATAGCTTCACAGAAAGCTGTATCGATTATTCTTCGAAGAGA
AGCTGCTAAAGCAGTGATTGAGTATAAGAAGAAGAAAGGGAATTCGAAGAAATTATTGCCTCGTACTGTTCTTGAAGCTCTTCATGAACGTATTA
CTGCTTTGCGTTGGGAATCTGCTCTTAAGGTCTTTGAACTCCTCCAGGAGCAGTTGTGGTACAGGCCCAATCCGGGCATTTATATCAAATTAATT
GTCATGCTTGGAAAATGTAAGGAGCCTGAGAAAGCTCAATCTTTATTCGAGATGATGGGTGGAGGAAGGCTGTGTCGTGAATCAAGAAGCTTACA
CTGCTCTTTTGTCCGCCTATAGCCGTAGTGGTCGCTTTCACGAAGCTTTTTCTATCCTGGAAGAGATGAAGAACATTCCGAACTGCCTCCCCGAT
GTCTTCACATATAGCATCCTGATAAAATCCTGCCTGCAGGGTTATGACTTCGANCAAGTGCAAATCCTGCTTTCCGACATGGAATGCATGGGGAT
CAAGGCCAATACAGTACCATATAATACTCTTATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423020] SGN-U286539 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275157 [Download] [View] Facility Assigned ID: STMGF65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5