Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E423222

Search information 
Request: 423222Match: SGN-E423222
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274733Clone name: STM-41-P5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423222Length: 866 bp (1129 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E423222 [] (trimmed) TTTTTTTTTTGTAACTCTAATAGCAACCTTGATCAAAGGGCTGATTTCTTTCTATACAAAATTGGCAACTGAAAATAGTTGTTGCAGTGTTCTCC
AGAAATACTCTAGGAGTAAGAATGCACATTTAGGCACTGTACATTAAGATTGCATTTTCAATTTTGTTCAAGGAGTATTCTTGCTCTGTTCTGCA
GTCCATTCAACTCACCAAGAATCACATCCTTGTTGTCGTCATATTTATTGTGTACGATCAAATTTATCAATTTTTGGAGCAGTGTTGCAGTCTTT
CCTGTCAAATTCTCAGAAGGGTTTTCTTCAGATTGCTTATTGTGGCCATAAATCTCAAGCGCCTCAGATTTTGCAGCAGCTCTCTGAAGCACATC
ATCAGGAAGTCCAGCAAGCCGTGCAACATTGACACCATAACTTTTAGGACATGCACCTGGTGTCAACCTGTAAAGAAAAGTAACTTCCTCAAGAC
CTCCGGAACCTTTTCCAATTTGGCATGCCATATGGCACAGCGACACCCTGGAGTCTTTTTGATAGTCAATAGATAACCGATGATAGTGGGTAGAA
AACATTCCTCGACATTGCACCTTGTGGACAAAGTGTTCGAGAACTGATTCAGCTATTGCTTGTCCATCAGAAGTAGATGTACCGCGGCCAAGTTC
ATCAAGTGCGACGAGTGAATTACGGCTTGCCATAGACAGCATTGAAGCAGTTTCCAAGAGTTCTGTCAAGAATGTACTCTGGCCTGCCATAATAT
GATCTTTGGCGCCCATTCTTACAAATATACGATCAACAGGTGATATGTCAAACGATGATGCTGGTACATCAGCTCCTACCTGGGCCAAAATTACA
GCCATGCAGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423222] SGN-U280677 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275359 [Download] [View] Facility Assigned ID: STMGG87TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5