EST details — SGN-E423343

Search information 
Request: 423343Match: SGN-E423343
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274648Clone name: STM-41-L8
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274648 [STM-41-L8] Trace: SGN-T275479 EST: SGN-E423342 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423343Length: 908 bp (1057 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423343 [] (trimmed) TAGCTACAAATCCAGTGTAAACATTGAGTAATTTTTTCTAAAAGCTAAGACTGATTCCACAAATCCAGTGTAGTTTTCCCGCATCAGAGATCCAG
CACAGACAACTAACAACGCGCCATGAAAGTAAGACTTGTCTGCTTAAGACAACTATGCCTTTGCTGTCTAAAGCTCATTGGTTGTGGTTCTTGGA
AGCGGAGTTATCTAGTTGGCATCCAACTTATTTAACTTAGCAAACATGTTCCCATAGAATTTTGCATCCTTCTTATTGAATTCCTTAACTTTTTC
CTTCAGAGCTTTGTATTCAAGCTTCACATCCCTGTTGTTAGGATCAATCTCAAGGGCTTTCTTAATGTCAAATTCAGCTAGATCAAGATCTGCCA
TGTTCATATATGCTTGAGCTCTCCGGTAAAGAGCTTTAACATTAGTACTCTCAGTTTCCAACACCTTGGTACACAGCTTCTCTGCCTGCTTGTAA
TCTTTCAGTTTCAACTTGCAAGCTGCATTATTTAAGTTGCAGCTGATCTTCAAAGCTTTAGCTTGTTTCTTTTCCTCTTCACTAAAGTCAGAATC
ACCTTCAATAAATTTAGCAGCCTTCTCATATCTAGTTGATGCTCTTGCATATTTACCAGCCTTGAAGAGAGCATTTCCTTCCTCTTTCTTTTTGC
CAGCAGCCTCAATTTTCTCCTGGGTATTCATATCCCATGATTCCTTTTCCTTGACAAAGGAAACCAGCTCAACCTCATAATATACAGTTGAGTTG
GGAGGAACAACGCCTAAGTCTTGCTTTGATTCAGATGGACCAAAGGCATAATCAGGTGCAATTATTAGCAGTGCCACTTCACCCTTCTTCATTGA
CATGACAGCTCTATCCAACCCATCTATAACTTGCTCCTCATCTGTCTTAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423343] SGN-U268749 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275480 [Download] [View] Facility Assigned ID: STMGH64TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0103 Quality Trim Threshold: 20.5