EST details — SGN-E423372

Search information 
Request: 423372Match: SGN-E423372
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274681Clone name: STM-41-N18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274681 [STM-41-N18] Trace: SGN-T275508 EST: SGN-E423371 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423372Length: 302 bp (1128 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423372 [] (trimmed) TTTTCTTCCATGTAGAAAAAACTAATTGAGGGCCAATTTTACAAAATTACTAAAAGTACAACTTAGCCTAACTCCCTAATCTAAGAAGATTAAGT
TGAAGTGCCAAAAAAAAATTGGTTGAGTACTAAAACAATACAACGATTGAAGGTAGTGTAATGGCTTTGGACTCGCCTCCACTTTGTTGATTGAA
AGGCTCACCTCCACTTCTCCTGTAAATCTTTCCTCTCAGACCAAATCCACGTTACGAAAATTGATATAACTAGGGCAACTATGGTAAGGAGAAGC
AAAGCATAATTGAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423372] SGN-U275863 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275509 [Download] [View] Facility Assigned ID: STMGH81TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0131 Quality Trim Threshold: 20.5