Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E423581

Search information 
Request: 423581Match: SGN-E423581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274750Clone name: STM-42-A20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274750 [STM-42-A20] Trace: SGN-T275717 EST: SGN-E423580 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423581Length: 590 bp (900 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423581 [] (trimmed) ACAAAATAGTTTCCAAATTACATATTCACTCATTTTGCCTTATTTTATTTTTATTCTTGTTACTTTTAGTACACATTTCAAAGCACACTCATTAA
TAACAACAAACGTACGTTATTACAAGACTTGAGACAACATCTTAGTTCCAAGCATTCACCATATATTGTTCGTACTCTTTAAAAATATTGGCACA
CATGTGACAGTATAGCATCTGTCAATATATTTTCAAAGAATCCGAGCAATATATATATAGTCGTAGGTATTTATCAATTGAGATGGTGAGTCTCA
ATATCTTTTGTGACATCAAGACAAAATTTCATTAGTGTGTGAGGATCTGGAATATCTTGATTCAGCTTCTCATATTTCAAAATCCAAGTAACTAA
ATTGTCTTCACCCTTTGTTTCAACATGAACAGTGATGTAAAATGATTTGTAATAGTCCAATATATCTCCTCCAATCACCTTGAATTTAACAAGCT
TCTTTTCTTCATCTATTTCTTCAATTATTTCCTTTGCAACCTTTTCCTTCCCATCATGGGTAAAATTCCAAAAAATGACAGAGCCAACGGTACCC
CATTCACCTTCATGAATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423581] SGN-U270993 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275718 [Download] [View] Facility Assigned ID: STMGJ10TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.926 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5