EST details — SGN-E423663

Search information 
Request: 423663Match: SGN-E423663
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274932Clone name: STM-42-I18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274932 [STM-42-I18] Trace: SGN-T275801 EST: SGN-E423664 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423663Length: 589 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E423663 [] (trimmed) AAAAATCAGGGCAATTAGGGATATGCTAGGAAAATCAACTGATAGGGCTAGGCCAGCTATGCCTGTAGAGATCGAAGGACTCAAGGGGCTTCCAA
TGGCTGGTGATGACATTATTGTCGTTCACTCTGAGGAAAGGGCAAGGATGCTTAGCGCAGGGAGGAAAAAGAAATTTGAAAAAGATAGACTTGGG
AGGAAGATGGACGCAGAAAAATTAGGATCTCTAGTATCAGAATCTAATTTAGAAGATGAAGAAGGTGAGGTTGAAGAGAAGCCCAAGAGGGTTGA
AATGACAATAATAGTAAAAGCAGATGTTCAAGGAACTGTCCAAGCTGTTACAGACTCATTGAAGAGTTTGGATAGTCCTCAGGTTTTCGTGAATA
TTGTCCATGGAGGTGTTGGGCCTATTTCTGAGTCCGACGTGGATTTAGCACAAGCTTGTGGTGCATTTATTGTTGGGTTCAGCATACCAACTCCA
CCTGGTTCAATAAATCAAGCAGCAAATAAAGCTGGCATTAAGATAAAAATCCATCGTGTGATCTATCATCTTCTAGAGGATATTGGCAACTCTAT
TGTTGAAAAAGCCCCCGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423663] SGN-U275780 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275800 [Download] [View] Facility Assigned ID: STMGJ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5