Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E423731

Search information 
Request: 423731Match: SGN-E423731
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274783Clone name: STM-42-B9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274783 [STM-42-B9] Trace: SGN-T275867 EST: SGN-E423730 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423731Length: 777 bp (882 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423731 [] (trimmed) AATACTTTTTTTGTTTTTTTTTTTCAGAATATCCAAATGATTAGTAACTGAATACCAATTAGGCAGTTAATGTGGAGACAGATCATAGAAGTAGA
TATAATTTAGAAGATAAATAGATAAGAAATGCCAACTAATAATTATTAGAGGGGAAGTATGGTATCAAAGGTAGTTGTGTGTACATGAATAATAA
GATGCTTCTAACTCTATTAAAAATTTGGAAGAGCTTGAGATGAGCCACAACTTCAATTTTCTGTTTTTTGGTCTATGGTTGCTTAATTAGAACCT
TTATTAGCATCAGCTTCACTCAGAGGAGTTTCGGAGGATGGTGATGGTGGTGAAGTCCACACAAATTCCCGGGCTTCAATCAGCATGGTGATGAC
TTCTCGCATTGTAGGCCTATTGGCAGGGGATGTATTGGTGCAGAACATAGCAATCTTGAGAACTAGAGACATCTCCTCTCTTGTTCTTGCAACAC
TAACATCCAGTCTTTTGTCAAAAAGCTCAGTTAGTGCCACTCCTTCATGAATTGATCTCCTTACCCAAGTCACCAAATCGCCTCCCTGATCAAGG
GGTTGAACTGGAGACCTACCAGTAATCAATTCCAACAAAACAACGCCATAACTATAGATGTCGCATTTCTCTGTCACTTTCATTGTGTATGCATA
TTCAGGGGCAATGTAGCCGTATGAACCAGCAACCGCGGACATGGATTTTGAGTAAGGGAAGTCAATTAGCTTTGCCAAGCCAAAGTCTCCTACAT
GTGCCTCAAGCAATTCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423731] SGN-U279112 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T275868 [Download] [View] Facility Assigned ID: STMGK05TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5