EST details — SGN-E423939

Search information 
Request: 423939Match: SGN-E423939
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C274857Clone name: STM-42-F10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C274857 [STM-42-F10] Trace: SGN-T276075 EST: SGN-E423938 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E423939Length: 562 bp (865 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E423939 [] (trimmed) TTTTTTTTTTTTTTTTATCTAAAAATGTCACAATAAGTTATTGGGACAATACATTATCACATCATTTAAAATCCAAATTAACAAAAAAAAAAAAG
CCTCTTCCTTCTTTGCATGGGCAAGATGAGAGACTATTTAATTATATATACAATTCATCACCAGAATTTTAATTAGCTCTGATGATCATCTAATT
AAACGTTAGGATTAGCTGCAAAATAAGCAAGTGCACCAACAAATGGGGCATTAATATAAGTAGTTGGCTCTGATTTACGAAATTCATCTCTATTA
TCATCATAAACATCATCTTCTCCAGGACCACCAACAATTGCACCAACTAAAACGTTAGGATTAGGCTGCGATGAGTTAAAATAAATCGAGGCCTC
ATTGCATCCGATGACCTGAGGATGATCGTTGATCGATGGAATAGTCGAACCACGATGATGAATTTTTTGAGGATAGTAATTACTATAACCAACCA
TGTATGATATACCTTTAGGATTTTCACCTAAAATGTAATCAACTTGTCTCTTACCAATTTTTCGAAGCATAGATGGACTAACACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E423939] SGN-U281396 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276076 [Download] [View] Facility Assigned ID: STMGL29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0072 Quality Trim Threshold: 20.5