EST details — SGN-E424221

Search information 
Request: 424221Match: SGN-E424221
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275112Clone name: STM-43-A20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424221Length: 481 bp (962 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E424221 [] (trimmed) ATTTTTCCGGCAATGGTTCTGTAAACTGCATATTTTTTCTGATTGGAGACTAAAAATTAAAGGCCTCTTCAGTTTCTGAAGTTGTCTTTGCTTGT
TTTAAAAGTGTGAATGGCAAAGGTCTGTTTTGGAGTTGTAACTGAAACTGATTCATCGTCACCGTGTGAATCAAGTTCACGGGCGGTGAGGAGGA
GGAGAATGGAGCTTCCAAAGATAAAAGTCATCGCTGGAGTAACTCAATCCGGAACAGACAATGGAATTAAACGTCCAAAATTGAAACTTATTTCC
GGCTCTGTTTCAAGGATTTGTGATAACGCTGTGGAAAGTTCTATCACCGACGATGATGAAGAACAACTGAGGTTAGTATAGACGAAAGGGTCACC
GCCAACTATTATTTTGACTCCATTTTTGGGTCCTTCAAATTCTACTCTCCTTGTTCAATCAGTGGCTTACCCAAAGTTTGGCTTCCCCTCTGTTT
GCGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424221] SGN-U279934 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276358 [Download] [View] Facility Assigned ID: STMGN10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5