Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E424432

Search information 
Request: 424432Match: SGN-E424432
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275274Clone name: STM-43-H3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275274 [STM-43-H3] Trace: SGN-T276570 EST: SGN-E424433 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424432Length: 524 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E424432 [] (trimmed) CGATTGCGCCTTTGGATAAAATCTGCCTCCTTAGTTGTGGAGCGGCAGCAGGTCTGGGTGCTGCTTGGAAGGTTGCAAATATCTCTGAAGGATCA
AAGGTGGTCATTTTTGGTCTTGGGACTGTAGGACTTTCTGTTGCACAAGGTGCTAAAATGCGGGGAGCATCTCAGATTATTGGTGTGGATATGAT
GCAAGAGAAATGCGAAAAAGCAAAGGCTTTTGGAGTGACGGACTTTTTGAACCCAAAGGATACTGATGAACCCATTCCACAGGTTATAAATCGCC
TAACTGGTGGAGGTGCAGACTATGCATTTGAATGTATTGGAGATACCGGAATGGTTACCACTGCTTTGCAGTCTTGTTGTGATGGATGGGGCTTG
ACTGTCACACTTGGAGTACCCAAGCAGAATCCGGAGGTAACAGCTCATTTTGGACTTCTTCTTTACGGTAGAACATTGACAGGATCTCTATTTGG
AGGATGGAAACGAAGTCTGAAATTCCTTCATTAGTTGAAATGTACCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424432] SGN-U281168 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276569 [Download] [View] Facility Assigned ID: STMGO38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5