Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E424555

Search information 
Request: 424555Match: SGN-E424555
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275178Clone name: STM-43-D2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424555Length: 447 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E424555 [] (trimmed) CAGAGGTCGGGTCCCAAATAGTAAGTCGGGCCCTAGTTTCTTCACCCCCACAATCTCCGTCGAACTGGCGATGGTCGATAACTTCGATGATATCA
TCAACTGGGACGATGTAGATCACATCTTCCACAACGTTCTAGACAATCCCCACGATGATGATCAATTCACTCTTCATGATTCCTCCCCACAGACA
TTCCAGCAGATCGAGCAGCTTCTTATGAACGATGACGATGTCGGTCTTGTCTCTTTTGAAGACGCTGATCCTCAATTTGCTGCCGACTTTCTCTC
TAACGTCCTCGTCGATTCCCCTCTTCACTCCGATCATTCTCACTCTCCTGCTGAACAAGCCATTGGATTCACCGATTCCAAGGTTTCTAGTGGAT
CCGACGCCGATCAGGACAAACTCAAGTCACCTTCTGATGGGGACGACGAACTAAACAACCATGACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424555] SGN-U270357 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276692 [Download] [View] Facility Assigned ID: STMGP13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5