Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E424791

Search information 
Request: 424791Match: SGN-E424791
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275663Clone name: STM-44-I5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275663 [STM-44-I5] Trace: SGN-T276929 EST: SGN-E424792 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424791Length: 483 bp (953 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E424791 [] (trimmed) GGTGGATATAAAAGTGCCAACAGAATTTCAGGGCACTGTTACTGGGGATATCAATAAGAGGAAAGGTGTCATAATCGGCAATGACCAGGAAGGAG
ATGACTCTGTAATTACTGCCAATGTTCCTCTCAACATGATGTTTGGGTACTCAACATCTCTTCGATCAATGACACAGGGGAAAGGTGAGTTCACA
ATGGAATACAGAGAGCATGCCCCAGTTTCAGGAGATACGCAAACGCAACTTGTTAACGCATACAAGGCCAGCAAAGAAAGTTGAAAAGATGGTGT
GCCTTTGAAGCTCCTGCAACTACATCCTGTTTAATTATTTTTTTTATGAATTTGTCTCCTTGGGTGGGAGCAATGTTGTGAAATCCTTAGGACCA
GAATTGGTCAGTCAATTTTGATATGCTGAATAAAACAATAGCATTCCATAATGTATACAAATAATTGCTTATATACATACATATAGGTTGTGTAA
AAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424791] SGN-U271113 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T276928 [Download] [View] Facility Assigned ID: STMGQ51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0013 Quality Trim Threshold: 12.5