EST details — SGN-E424996

Search information 
Request: 424996Match: SGN-E424996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275753Clone name: STM-44-M4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275753 [STM-44-M4] Trace: SGN-T277132 EST: SGN-E424995 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E424996Length: 451 bp (884 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E424996 [] (trimmed) ATAAAACAAAATGTTTTTTTTTTTTTTCCAACCCCCAAATTGATATGTATAATCGATACGAGAGTGTACAATACAAGAGCATACCAACTTCTTGG
TGAATTTGTAAAACACGTACATATACTAACCAAAAAAGTGTGCTCGGATTATAAACACCCTCATCTGGCTACTTCCAACCTTGAAATTGTGAGTT
CGAGTTATCAAGGAAGCGAAAAGGTGCGAGCGACTAGGGAAAGGTAAAAAAAAAAACTGCTTATCTAAAGCTCTATGAAATGCCTTTTCCATGTT
TTGTTATCAAAGGCCTATACATTTACAAAGGCAAATCCAGCACCGTTGAAAATTACCCACAGTGCCAAAAACATTTCACTGTTATCCAAAAACTG
CTAAAACCCAGCATTATCACTTGGAAAATTGGCTGAAATCAATTCTTGGTACTTGCAAAAAAATCCCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E424996] SGN-U273472 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277133 [Download] [View] Facility Assigned ID: STMGR74TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0238 Quality Trim Threshold: 14.5