EST details — SGN-E425059

Search information 
Request: 425059Match: SGN-E425059
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275497Clone name: STM-44-B23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275497 [STM-44-B23] Trace: SGN-T277197 EST: SGN-E425060 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425059Length: 672 bp (990 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E425059 [] (trimmed) TTCACTTTCAAACCTTGAAGAGCTTTACCTTGACAATAATTTCCTTGAGGGAGAAATTCCCCAAAGTTTCAACGGTCTCAAGAATTTGAAACGGC
TCGAATTTCAAGGCAATCAGATTACTGGCGAGTTTCCCGAGTTGGATCAGTTAATTAATTTGAATTTCATCGATGCTAGTGATAATGCTATCTCC
GGCGAACTCCCGGCGAGTTATCCGGCATCTCTCATCGAGCTTACGATGAGAAACAACAGCATAGAAGGTAACATTCCGGCGAGCCTCATCGGACT
GAATTTCGTACAAGTTATCGATCTGAGTCACAACAAACTCAGTGGGTCAGTGCCAGCGAGTCTCTTCACTCACCCATCCCTCGAACAGCTCACCC
TATCATACAATCAATTCGGGTCGGTTCAGGAACCCGGGATCTCGTTTCAGAATAGTCAGCTTATTGCAGCAGACTTAAGCAACAATGAGATCCGT
GGGTTATTACCCGGGTTCCTGGGTTTAATGCCTAGATTATCATCACTTTCACTAGAGAACAACAAGTTATCGGGTATGATACCGACCCAATATGC
ATTGAAAATGGTGTTTCCGGGGTGAAGGGGTGTCTCAATTTGAGAGGCTACTGTTANGAGGAAACTATTTATTCGGACCCATACCGGGTCCATTG
TTGGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425059] SGN-U279111 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277196 [Download] [View] Facility Assigned ID: STMGS12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.993 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5