EST details — SGN-E425206

Search information 
Request: 425206Match: SGN-E425206
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275483Clone name: STM-44-B10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275483 [STM-44-B10] Trace: SGN-T277344 EST: SGN-E425207 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425206Length: 666 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E425206 [] (trimmed) GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTAATTCTAAAGCTGAACTGATTCCCCAGCAGCATTATAACTCCAAATCTTCAACAAACAGGA
ACAAGTAGAAAAATTTAAAAGCTCATAAAATATAACTTACGCAACACCAAAAGCAAATATCCTGAGGCACCTGGAAAACCAAGGCACCTCAACAG
AATGAAAACAGACTCCAAATCATGCTCGCCACCGCCTGTCAAGTACCCAGTTCTGAGAATGGTTACATGACATACAAGGCAGAAAACAAGAGCCT
AAAAAGCAAATCAAAGACACTATAGCAGAAGTAAACAAAACAGAGTCTTGATAGCACACTTGATGAAAATAAATAGCATTGGAAACACTAGCATC
ACACTGCACTGTTCACTTTCCCTTCTTCTGGGCAGCCTTGGTGACCTTGGCACCAGTTGGGTCCTTCTTGTCAACATTCTTGACAACACCGACAG
CAACAGTTTGCCTCATGTCTCTCACAGCGAAACGACCCAATGGTGGGTATTCGGCAAAGGTCTCAACAACCATGGGCTTAGTGGGAATCATCTTA
ACCATACCAGCATCACCATTCTTCAAGAACTTAGGCTCCTTCTCAAGTTCCTTACCTGAACGCCTGTCAATCTTGGTCAAGATCTCAGCAAACTT
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425206] SGN-U277723 Solanum tuberosum Build 4 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277343 [Download] [View] Facility Assigned ID: STMGT05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0091 Quality Trim Threshold: 12.5