EST details — SGN-E425238

Search information 
Request: 425238Match: SGN-E425238
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275542Clone name: STM-44-D20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275542 [STM-44-D20] Trace: SGN-T277374 EST: SGN-E425237 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425238Length: 684 bp (913 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E425238 [] (trimmed) CAAAACTAAATTTGATTACCTCTTTAAATTCTTCTTTTGGTTACTCATCTAAATACCGTGAAATAAGAGGGAAAAGTACAATTTTTTATAATTAC
TTTTTGGTTTTGGGTAATATCCATTACAAATTCAGGTTTTTTTTTCTCTTTTTGTATACCCATTTTGATCTGAAGCGTTAATTAATTTCTGGGTG
TTGAAGATTTCAAGCGAATCTATTGTGGTAGTCATGTTTTTTCCTTTGAAGGATTGAGATCGTGATCTCAACTCTCAGATCTGTTTATGCATCTG
CTGTTACATATGGGCTGAGATATATATTTCATGGGAGGTGCAGAGGATGATGAACCACTCTCAAAACGTGTGAAAGTATCATTTGAAGAATCAGC
TGATCGTTCGAACGGGACATTTCTTAGGGATCCTGCAAGTTTCCCATTGAGTGACTTGATGGTTCGTCCTCTGGAATTTCAAGGGGACGATGAGA
TTGTTGGTAGAAAAGGAGTAGTCAAGAAAGTTGAATTAGTTCAGATCATAGCCGAGGCGTTATATTCTCTTGGCTATAAGAAGGCGGGGGCGCAG
CTAGAGGAAGAGTCAGGGATACCTTTGCACCCCTCTTTAGTAAATTTATTTATGCAGCAAATCCTTGATGGGAGATGGGATGAAAGTATAGCCAC
ATTGCATAAAATTGGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425238] SGN-U281399 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277375 [Download] [View] Facility Assigned ID: STMGT22TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5