EST details — SGN-E425539

Search information 
Request: 425539Match: SGN-E425539
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275836Clone name: STM-45-A2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275836 [STM-45-A2] Trace: SGN-T277677 EST: SGN-E425540 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425539Length: 736 bp (925 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E425539 [] (trimmed) TAAGTTCTCTTGTGTTTGGAAGAAAGTGAAATGAAGTTATCTATAGACCACATCCTTATGTACAACCTTGACAATTGATAATTTGCTACTCAGAA
AATTCAAATCCAAAAAAACTTTATCACTAGCCAAGAATTAGCTCATCATGGATTACTTCTTCTGGTTTTTCTTCTCGTTTGCCATACTAGTTAAT
AGTAATTTAGGTTCGTCCGCGGACGGACCTTCAATTAACGTGACGAAGCATATCTCTTTTCGAGATTTCAGTTCTAGTAATCCCAGATTGAAGCA
AGATCTTACACTTCTCGGTAGTGTTATCGTCTCGGATGAAAAAAAATCCGTTCAAATTCCTGATCCTGAGCGAGAAGGTGATGATCTAAAGCATC
TAGCAGGACGAGCTATTTATTCTTCACCTATCCGTTTCTTTGATCCTCGGACTCAAACACCGGCTTCCTTTGAAACGACTTTCTCGTTTCAATTT
GAAGTGAAGTCCAATTCAAGCAATGAGACGTCAGATCAGGGGAAATCTGTTGGTGGTAGTGGCCTTACTTTTATAATCGTTCCGGATGAATTGAC
TGTTGGCCGTGCTGGTCCGTGGCTTGGGATGCTGAACGATTTGTGCGATGAGGATTATAAACAGTAGCTATTGAGTTTGATACTCGGCAGAAACC
TGAATTGGNTGACCCGAATGATAATCACTTGGGCATTAATTTGGGTAGCATAGTATCAACTGCAGCGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425539] SGN-U283733 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277676 [Download] [View] Facility Assigned ID: STMGV01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5