EST details — SGN-E425551

Search information 
Request: 425551Match: SGN-E425551
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C275834Clone name: STM-45-A18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C275834 [STM-45-A18] Trace: SGN-T277689 EST: SGN-E425552 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E425551Length: 725 bp (962 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E425551 [] (trimmed) CTTCACTGTACTCTCAACATTTAGCTTCGAAGTTGTTCCAAGATGATGGGTTTATTGCGTGCTGTGGCTAAATCGAACCGTTCGATTCAAACGAG
TATTCAAAATCAAGGGCTGACATTGCCTCTCTGCAGACAGTTTTCGACCCAAATGGAAACACCCCAGAAGGACAATTCATCTGATCCATTCCCCC
GAAACCCATCTTCTGGTTTGGTTTATGGGAGACTTTTTGTCACTGGAAAGCATACAAGGAAGAGTGACATTCTTAACATGTTAGGGAGTTCTAGA
TTGAGCCCAGATGACGTTAGATTTGAGTACAACATGAACTATGCTCCAGTTTCAGTGATGATTCAGTTCCCTACTCGAAATTCTTATGAGGCTAC
ACTTAGGGAAGGAAATCGGAAGGGTGGCTTATTCAGAATGGAGAGGGTTGGTCGTCAACAGTGGGACACTTTGCCACGCTATGATGGAAAAACTA
TTTTATTGGTAGGGGTCCCTCGAAATGCAGTGGCCGAAGATGTGGAACGTTTCCTTGCTGGTTGCCAGTATGATGCATCAGCAATCCAAATGTTC
GGCAGACCACAACGAGCTGCTGATAGACCACCAACTAGAACAGTCTTTGTGGAGTTTCCCTCGCAGGCTAAGGCAACACATGCATTTATTACGAA
GAACAGAGGCTTCTGTCTTAATACCAAATTACAGTGCGACTTCTTCAGTAATCTCATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E425551] SGN-U272586 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T277688 [Download] [View] Facility Assigned ID: STMGV09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5