EST details — SGN-E426061

Search information 
Request: 426061Match: SGN-E426061
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276214Clone name: STM-46-A5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426061Length: 837 bp (926 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426061 [] (trimmed) CAACCACCTTTTTGTTTTATGTAGAATATGTTTTTCGACAAAACAGCGATGTCAAGTTTAACGATTTGTACATACTAACGAATGTAATATAAACA
AAATAATATAGCACATGTTGCAGTTTACGCAGATAAGATTAGCGTGGGATGGTGTAGCATATGTAGAGGACACAGCAGTTTGCCTGTGCGTAGGT
AATCTTGCTGATGCAAAAAACCAGAGTTGAGGGACAGTGAGTGATTATATTGTCCCTAGGATAAGCAAGAGTGACAAAATGGTGTGACGTAGTTC
CTTTTACACCTTTTTGGTAGGTGTGGGTGGTTCAAATTTTGCAGGTGCATTTGAAGGACCAGCTGCAGCAGTTGTTGGCATCAGTTCTACTTCAG
TTATTTCCAAAGGCTTGATTTTTTTAGAAGTCCTATCTGTAGTGCCCAATGCAGTATGGGGTTTTTCCATGTAGGAAAGAATGGACAAAGTTGCA
TTTGTTGTATTGGAGCTGCTCCAAGATGACTTCCTTAGCTGAATTTCGAATGTTGTGTTTGACAGCATGTCATGGACATGATTAAGAGACAATGA
TTGTCGCTTAGTGCAAGTTATGTCAAATATGTCTTCTGCTGTCATGGAAAGCAACTTTTTTCCTAATTCAGCAGAGATAGATGCTGTCGTTGTAG
CAGTATTGTCGATAAGATCAATTTGGAAGCTACAGCGAGGCACTAATGATGTTTTCCGGTTGCACTTTGGACATTCGAAATCCTTTCTATCCTTT
GTCCGCTTCTTCTGTTTGCAGCCTGAGCATTCAAGCACACAAAAGTCTTGGAACTCATCTAATATGGCCATCTCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426061] SGN-U268176 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278198 [Download] [View] Facility Assigned ID: STMGY03TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5