EST details — SGN-E426225

Search information 
Request: 426225Match: SGN-E426225
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276213Clone name: STM-46-A4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276213 [STM-46-A4] Trace: SGN-T278361 EST: SGN-E426224 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426225Length: 152 bp (760 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426225 [] (trimmed) CCCTCGAGTTTTTTACAACTTTTTTTTAGTAATAACCATCAACTTCTATTATTGATGAACACTTTTGTCCTTGGATACATCTATGTTTGCATAAA
ATGTAAAGTACTAGGATGTTGACTACAGTTTTGTCCTCCAAGTGCTACTTGTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426225] SGN-U271013 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278362 [Download] [View] Facility Assigned ID: STMGZ02TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0233 Quality Trim Threshold: 20.5