EST details — SGN-E426239

Search information 
Request: 426239Match: SGN-E426239
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276259Clone name: STM-46-C4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276259 [STM-46-C4] Trace: SGN-T278377 EST: SGN-E426240 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426239Length: 588 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E426239 [] (trimmed) CTACCAACTTATGCCACCATTGAATGAGGCGTCTTCCATATTCAGCACTTCTCCTCAATAAGTGCAACTTCATAACCTTAATCAGCAAAGCACGC
CAGCTCCATGCCCTCATCCTCACTTCCATACCCGCCACCTCCAGATCTCCTTATGTATTCAACAACATTCTCTCCATGTACGCCCGATGTGGGTC
TATCCAAGACTCACATATCCTGTTCGACAAAATGCCTGAGATAAATATTGTCTCTTTCAACGCCCTCATTTCCGCCTATTCTCGATACCACCACC
TTGCCCATTGGGCTTTCCATTTGTTTGCTCAATTGCAAAGTGAGAGCATAAGACCAAATGGATTAACTTTTACTAGCCTTTTAAATGTGTGTTCG
GGTATCAAGAATCAGGTATTAGGCTCTATGCTTCACTCCCAGTGTATAAAGTTTGGATTTTTATACGATGTGTGCGTTCAAACCTCTGTTCTTGG
GATGTACTTAAATTGTGGAGTCTTGGATTGTGCAGAGAAAGTGTTTTGCTACATGCATGATAAAGATTCTGTGGCTTGGAATACTCTATTCTTTG
GGTATTTGGAAAATGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426239] SGN-U279827 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278376 [Download] [View] Facility Assigned ID: STMGZ14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5