Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E426269

Search information 
Request: 426269Match: SGN-E426269
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276291Clone name: STM-46-E12
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276291 [STM-46-E12] Trace: SGN-T278407 EST: SGN-E426270 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426269Length: 667 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E426269 [] (trimmed) CGAGATCCAACTTTTCTCTGAGATTCTGCAAGTAATAGTAAATCTAAATATGGGAGAAAACAAGGAGAACGATGCTTATGAGGAGGAGCTTCTCG
ACTATGAAGAAGATGACGAAAAAATTCCTGATTCCGCCACAAAAGTCAACGGCGAATCGGCCAAAAAGGGTTATGTTGGAATTCACAGTTCAGGT
TTCAGAGACTTTCTTCTAAAGCCAGAGTTGCTGCGTGCTATTGTTGATTCTGGGTTTGAGCATCCGTCCGAAGGTAATTACTCCTATCACTACTA
ATTTGGAGATGTACCATGGTAAAATTTTTAAACTGAAACTGAGGTCTCGTTGCCCCCAATGTGTTTGGTTCATCATCAGTGCAACATGAGTGCAT
TCCACAAGCTATTCTGGGAATGGATGTCATTTGCCAAGCTAAATCTGGAATGGGAAAAACCGCTGTTTTTGTCCTTTCAACTCTGCAACAGATTG
AACCGGTTGCTGGTCAGGTTGCTGCCCTGGTTCTATGTCACACAAGGGAATTAGCTTATCAGATCTGTCATGAGTTTGAGAGGTTCAGCACTTAT
CTGCCTGATATCAAGGTTGCTGTTTTCTATGGTGGTGTCAACATCAAGCTCCACAAAGAGCTGCTAAAGAATGAATGCCCTCATATTGTTGTTGG
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426269] SGN-U281222 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278406 [Download] [View] Facility Assigned ID: STMGZ30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5