EST details — SGN-E426428

Search information 
Request: 426428Match: SGN-E426428
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276317Clone name: STM-46-F17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426428Length: 629 bp (925 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E426428 [] (trimmed) GTCACACTGAAGCTGTTCTTTCAGTTGCCTTCAGTCCTGATTGACGACAGTTGGCAAGTGGATCTGGTGACACTACAGTTCGTTTGTGGGATCTA
AATACCCAGACACCATTGTTTACATGTCAAGGGCACAGAAATTGGGTTCTTTCTGTTGCATGGTCGCCAGATGGTAAGCATCTTGTTAGTGGAAG
CAAGGCTGGAGAACTTATCTGTTGGGACCTTCAGACTGGGAAGCCTTTAGGGAATCCGCTTACTGGCCACAAGAAATGGATAACTGGTATTTCTT
GGGAACCTGTACACCTCAGTGCTCCATGTCGCCGCTTTGTAAGTGCAAGTAAAGATGGCGATGCACGGATATGGGATGTTACCACAAGGAAGTGT
CTCATTTGTCTCACTGGCCATACACTTGCAATAACATGTGTAAAATGGGGTGGAGATGGAGTTATATACACGGGATCTCANGACTGTACAATCAA
GGTATGGGAAACCACGCAGGGGAAGCTAATACGTGAATTGAAGGGTCATGGACATTGGGTAAATTCTCTAGCACTGAGCACTGAATATGTTCTTC
GAAGTGGAGCTTTTGATCACACCCATAAACACTTCGCATCTCCTGAGGAAATGAAAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426428] SGN-U275792 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278565 [Download] [View] Facility Assigned ID: STMHA33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5