Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E426442

Search information 
Request: 426442Match: SGN-E426442
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276372Clone name: STM-46-H9
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276372 [STM-46-H9] Trace: SGN-T278578 EST: SGN-E426441 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426442Length: 686 bp (927 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E426442 [] (trimmed) CAATCTTAATGGGGGAAAAAGAATATTTTTCTACCAAAATTACTTCAGCATGGGATGGGAATTAAGCTGTACAAAGTTGAGTTCATATTAAAATT
GAGTAATTATGACTCTTCACTGAAATAAATATGATGTAATCGATCAAACACTCACTACATGCTATGTACAATTCTGAGTCAGAAGTAGTACAACA
AGATCTAGAGAATAAATAGACTTGTGTCTTCAGCTTTTCATGATTCAGCTTGCTGACTTTCTTTCTTTTGGCGCGACTTGTGGTGGATCCTGGGA
AACAGTAGATCATTAAGTTGTCTTTCAGCACTATACTCTGATGAGGCCCGCTTTCTAAATGAAAACCGAAGTGTTTGGACTTGTGTCCCAGAGCA
AACTCTCAAGTCAAAACCAAGGCTGTCCACACCAATCAGAGACACCTCCTCCACTTGAATTCCCTTGCATCTCCAACAGAGAGATCTAAGAGCCT
GCATAGTCTTCTCTCCAGCAGCTTTAAGCCGAGATATTATTTTGGCAGCTGAATGTACAATTGCATCAGACCTAGCTCTCCTAAAATCATCTAAC
TCAACAAAGATCTGATTCCCATTGGAAGAAATTAACTGAATTCTGATCATCTCTAGCTTGTAAAATGAAGTTCCATTTCCTAAGTTCTCATCCTT
TTCCAATTCTTCCCAACTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426442] SGN-U284470 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278579 [Download] [View] Facility Assigned ID: STMHA41TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5