EST details — SGN-E426539

Search information 
Request: 426539Match: SGN-E426539
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276223Clone name: STM-46-B14
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426539Length: 660 bp (931 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426539 [] (trimmed) TTTTTTTAAGGGTTCCTTCCGTATAGCTATTGCTTTGATGATAAAGTTACAAACCAACCACAGTGCGTGGATAGGTATGCTATTCTATCATCCAC
AATCCCATCTCCATTTTCAAAGAGAACATTCTAAAAGAAACCCCATTTGCCTTGGGGAGGTTGGGGCAACAGGAGATAAATACTCCAAATAAAAA
GCCACCTTAGGAGAGCATTAACAAGAGAACTAAGTTAAAAAATTCAATATCAAGCATGGTACACCAATCAGGCTTCCAGCGAATTGCTACACTGA
ATTCAAGCAATTTGCAAGTCTGTATGTAGGAGATAAGTCACATAAGTTATTTCCCAAGTGCAGCTTCTTTTTGACATTTGCATGTTTCTTTAGCA
AAAGAAAAGCAGCGGCAGTACTTGACCATAAGCTGTCTTCAGGTAGAGCAGTTGTTCCTGTGTACCAGAGATGCATGCAGTGTTTGGTAGCACCA
TCCCACAAAATAACGTTCGAGCAGCAAAGAGAATAAATTAGTGTAAAACCCGGATAGCACCATAACAAAGATGTCTACATCTTGTCATGGAGAGT
AACCACCAAGTCATGGGCATCATCTAGAAGCTTCCATACATCCAGTTGACCAGCCATGCTCTGACACTCCCTTAAAATTTCATCCATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426539] SGN-U274737 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278676 [Download] [View] Facility Assigned ID: STMHB07TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0085 Quality Trim Threshold: 20.5