Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E426663

Search information 
Request: 426663Match: SGN-E426663
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276537Clone name: STM-46-P20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276537 [STM-46-P20] Trace: SGN-T278799 EST: SGN-E426662 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426663Length: 857 bp (907 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426663 [] (trimmed) CCCCACCTAAGGGGTGTTTTAAGAGAACATACACTTCATGTTCATCAATAGAAGGAAACAACAAATAGACACAACAAAAACCTTGCTTTTAGACA
GCAAGAAGGCCAATATTCAAACAGACAAGTGGAGATTACTACTGTTAGTCAATATGATCGCACGCCAAGCAGTGATCGTGTTCCATAGTTATCGG
TTAGATGCTGTGATCCTTACTGCAATGTGAAGCCTTCAGGTTCTGTTTCGATCGTTCATTCAGAGGCAGCTTGCAGTCTTTCTAATGCATCAGAT
ATGTGTCTCATTGAAGGTCTCCTCTCCGGGCTGCTTTGAACACACGCCATTGCAATCTTCAAAACCGCGATCATTTCCTCTTCTTTATCAGCATC
TTGAGCTAAATATGAGTCCAATACATCCGAAAGTGGCTTCTTCTCTTCAATGCACCAGTGAATCCAGTTTACTAGATCCATTTCTGTAGAACCTA
CTTGGATAATCGGGGTTCTTCCCGTGATCATTTCAAGCAAGATCACTCCATACGAGTAAATGTCCCATTTTTGTGATGGTTTCACCACTTTCAAT
GCCTCGGGAGCTTGGTAGCAAGAACCAGATGTTGTAGTTGATGTAACTGTCCCGGACTCTGATGGTGCACTGCCTTGTTTACTTTGTTGTGGTTT
CTCAGAAGTCATGTGGTTGGATTGCAACGTANGAGATGCTCCGGCTATATTAGCAGACGTCCAAGTCCAAAGTCGGAGATTTTGGGCTCCATGTC
GTGCCCAAGTAATATATTAGATGGCTTTAGATCCCATGAACATATTTCTTGGGACTGTACTCATGTAAAATAACCAAACCTTTTGCAGTACCCTT
CA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426663] SGN-U277590 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T278800 [Download] [View] Facility Assigned ID: STMHB94TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0254 Quality Trim Threshold: 14.5