EST details — SGN-E426885

Search information 
Request: 426885Match: SGN-E426885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276710Clone name: STM-47-I6
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276710 [STM-47-I6] Trace: SGN-T279021 EST: SGN-E426884 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426885Length: 217 bp (960 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426885 [] (trimmed) GTTGGATTTGTTAAATAAGGTCTGAATCAAATCGATTACAAAAAAATCTTTATACCAGTTAAATCACTATCTTTCTATTCATCAATGCATGTACA
AAAATACTATCCTAACTTATAAAAAATAGATATCTCTGGGTTTTTCTTTCTCTATTCTAATGAATTACATGAAAGACTTGGGTTGATGCCTCATA
TTTGGTAATGAAATTAAAACTTTTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426885] SGN-U276696 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279022 [Download] [View] Facility Assigned ID: STMHD51TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0073 Quality Trim Threshold: 20.5