EST details — SGN-E426889

Search information 
Request: 426889Match: SGN-E426889
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276696Clone name: STM-47-I10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276696 [STM-47-I10] Trace: SGN-T279025 EST: SGN-E426888 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426889Length: 546 bp (945 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426889 [] (trimmed) AGTTCATAGATTATTACTGTTGTCAAGCTACTTATGTGTGAAATTTTGTATCTCTTGCCACCAAAATGAAATATCAATGTCACAAATTTTCTTCC
ATGTAGAAAAAAACTAAACGAGGGCCAATTTTACAAAATTACTAAAAGTACAACTTAGCCTAACTCCCTAATCTAAGAAGATTAAGTTAAAGTGC
CAAAAAAAATTTGGTTTGAGTACTAAAACAATACAACGATTGAAGGTAGTGTAATGGCTTTGGACTCGCCTCCACTTTGTTGATTGAAAGGCTCA
CCTCCACTTCTCCTGTAAATCTTTCCTCTCAGACCAAATCCACGTTACGAAAATTGATATAATTAGGGCAACTATGGTAAGGAGAAGCAAAGCAT
AATTGAAATCATCGGTGAGAGAGTCGTATGTCTTTGAAGGAGCAAGCCGAGTGAAAAAGAGATCAACTCCGTGAGCAAAGATGAGGGTGGTTGAC
TCTAGCTTTGCCGGTATAGCTATTATGCTTCTAAGGCCTTCCACTTTAAGGGCGTGTGTAACGAAAGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426889] SGN-U275863 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279026 [Download] [View] Facility Assigned ID: STMHD53TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0068 Quality Trim Threshold: 20.5