Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E426893

Search information 
Request: 426893Match: SGN-E426893
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276700Clone name: STM-47-I18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276700 [STM-47-I18] Trace: SGN-T279029 EST: SGN-E426892 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426893Length: 836 bp (925 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426893 [] (trimmed) AAAATCTTTTTTAGTGAAACTATTTTATAGCTTTTATACTTCTGAATAATGGCTTCAATTCATCTACATATATAATAAGGACATAAATTCAACAA
AGGAAAAAGAAAACAGAGAAGAACTAATATGTAATTTATCATACTAGTTGTAACAATCTCATCGACCCGATGGATTCAAAATCTCAGAGAAAATA
GTGTCACTCTTCAATTTGTCATCACTATTACTGGTCATGGATGTAGCACTGCTTGTGTATTTTCCTCCAACTTCATGTGAACCTGAAAATGCCTC
GAATCCTTCATCTGTAGATATATTGGTATGATCATTCATAATCAAGGGGAAAGACGGGCTAGTCGGATAACTGTTCAATTCCATTTTGTGACCTC
TATTATCAGCTGCATCTTGAAGCTTTAATATAAATTCCAAATTCCAGACAACGTCATTCATTGATGGCCTTTGGACTCCTTGATCCTTCAAGCAA
TTATATGCTGCTTCTGCAAACTTGTTTAAGCACTCTGGCGCAATTTGTCCTTCCAAATTCGGATCAATTATTTGTTGAAGATTTCCTTTTTTACA
GCTCCTACAAGCCCAATCAGCCAAATTCACTTGCCCTTTCGGCATGTTAGGAATTAATGCTGGTCTAGCGCACAACACTTCGAATAGCACCACCC
CAAAAGAATACACATCAGATTTTTCTGTCAATTGTTGTCGCTTATAGTATTCAGGATCTAGATATCCAAAGCTTCCTTTCACAACAGTGCTAACA
TGGGTTTTTCCTGATCCACTAAGTGGACCGATTTTGGATAACCAAAATCTGAAACTTAGCAACCCATTATCATCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426893] SGN-U272895 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279030 [Download] [View] Facility Assigned ID: STMHD57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5