EST details — SGN-E426929

Search information 
Request: 426929Match: SGN-E426929
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276816Clone name: STM-47-O18
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276816 [STM-47-O18] Trace: SGN-T279065 EST: SGN-E426928 Direction: 5' Facility: TIGR
Clone: SGN-C276816 [STM-47-O18] Trace: SGN-T279067 EST: SGN-E426930 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426929Length: 444 bp (925 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E426929 [] (trimmed) GTTTTTTTTTTTTTTTTTTTGAAACCCAAAATTGAGAAGTAATTCCATAAATGGTCGATGGCTCTAAGATGGTACTGCATTTTAACTTATGCCTA
CATATTTCATAGTAAATAATTTTACAGAAGCGCAATTACACTCGCTTTTAAGTTTGGAAATTTTACAGGATTTGGCTTTTGAATGGAATATCACG
ACCCCTGTATTTGCCGCAGCCTAGAAATTGTTAGATCTGCACCACCAAATCCATCCATTATTGCTTTAGCTCCGGGAAACTCAGCTCTGGCCGTT
GAACTGCTCCGGACCACAACGCAAGGCATGCCAATTCGCTCTGCTCCAGCAACACCAGATAGACTTCCGGAAACAAGCACACAATTGTGCACAGG
TACATCGGCATATTCTGCCCCAGCCCTCAGTGCAGCCAACACATTCTGCAATCCTTCACTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426929] SGN-U275464 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279066 [Download] [View] Facility Assigned ID: STMHD93THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0113 Quality Trim Threshold: 14.5