Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E426955

Search information 
Request: 426955Match: SGN-E426955
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276601Clone name: STM-47-D11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426955Length: 478 bp (949 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E426955 [] (trimmed) GTGTTACTTGATCATAGCATAAGCATGGCTGCATATTCAGTTCCTCCTGCAGAGGAGTTGCTGTCAAAAAGAGTTCAAGAAATGGTCCTTCATGG
GGAGGAGCCACTAGGACCTTATATTTGCAGAAGTGGTGACGATGTTGATGAAAAAGAAGACATCATGGATACTTCTCCAATTCCTATAATTGATC
TAAACCTCCTGTCTTCTTCAACAACATCAGATAACGAACGCGAACAAGAGTTGGAGAAACTTGGATCAGCTCTATCTTCTTGGGGATGTTTTCAG
GGAATAGCACATGGGATTTCAGCTTCTTTACTGGACAAAATCCGCCAAGTTTCAAGGGAATTCTTCAACCAGCCAATGGAAGAGAAGAACAGAGA
GGTCTTAGAAGATTATTCTGAGAAAATGAAAATGGTCACAGAAATTACCTCTAAAGCTATGGCAAAGTCGTTGAAGCTGGAAGAAAAGTGCTTCT
TGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426955] SGN-U273617 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279092 [Download] [View] Facility Assigned ID: STMHE18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0036 Quality Trim Threshold: 20.5