EST details — SGN-E427101

Search information 
Request: 427101Match: SGN-E427101
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276613Clone name: STM-47-D22
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276613 [STM-47-D22] Trace: SGN-T279239 EST: SGN-E427102 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427101Length: 529 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E427101 [] (trimmed) GATTGTTTCTTGGATTTCCATGAGGCAGGTGAACCACCAAGAGTAATGTAATAACAGATCGACAAGCGTCAAGTTTATGCAACCAAACTCATTTA
ATAAATCCAATGTAAGTTTTCTTTGTCCCAAAATTATACCCTGATAATTTCCATGCCTAAGAAATAGTAAGCAACACCTAAATCTTTGATTCTAA
ACTCAGAGTTGAGAAAGAACTTAAGAGACTCAAGCTCTAAAGGATCATCCCCGATTAGTAGGATGTCGTCAACACAAACTGCTAGGATAGACACC
TTGCCTTGAACTTTCATAAAGAAAGAGTGAATAGTCGTTAAGAGAGTGAGAATACCCCTTGAAATTCAAAGCTGCAGTTAGGCGAGCATACCACT
GCCTTGAAGCCTGTCGCAAATCATATAAAGACTTTTTAAGCTTGCATACATACATGAGATTGACTGGGTGCTTGCATTCNANTNAAGCACTTCAT
ATAGACCTCTTCCCCTGCAATCACATGCAATAAGACATTATTCACATGCATCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427101] SGN-U280841 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279238 [Download] [View] Facility Assigned ID: STMHF23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5