EST details — SGN-E427117

Search information 
Request: 427117Match: SGN-E427117
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276651Clone name: STM-47-F24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276651 [STM-47-F24] Trace: SGN-T279253 EST: SGN-E427116 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427117Length: 778 bp (927 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427117 [] (trimmed) ATGGATGTCATCGTAATATAAACATCAAATCAGAAATCTTTCTAATAAAATTCATCCTCACCAAGAAAGATATGATATCAATACAAGCTCCTAAC
CTATCGTGACTTTGAAGGCTTACAAACAAAAGAATTACACAACCTCGTATAGTTGTATTCACCACACCACTCCACATTCCACAATAAAATGGGAA
GAAAAATTAACAGTGAAAAGAATCACATCACAGATAAAACTTGCTTGAATTTGACACAGACGATCTGCAATCTGCATACCGGATCCCAATTTCTA
GATGTGCAAGGAAATAGTTATTGGAATCCCAAGCTATTTGACAGAGGCAACTTAGCAACTCCAACATACATTCGGCTATGATCTAGGCAACAATA
GAAGGATCCTTTGCTGTCAAATTTGACAATGCAAAATTCCATTTCTCTCTCGTTTTTGTACCAGCAACTTGCCCTGCCTTGGCTACTTTACTAAA
AGCACCATTCAGCCAGGCAGCTCCAGCATTAACATACCTGCTTGATTTGACCGCTGATCCTGTGTCATTCAATTTCCGTTCTGCTGCCATAACTG
CAGCCATCGTTTTGTCTGACACTTGAAGCCTTTGATCAACAGATTTAACTTTCTCATTTACAACAAAAATTCCAACCGTAAGCTTTTCTGTTAGC
CCAACTCTTCGGTCAAAGGAAATGACTCGGGCAGATGCAGTGGCTCTTAGCTGATGTTTCTCATCAAATGCCTTGGCTTTATTCATTGCATCTTG
TCTGATAGCTGAACCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427117] SGN-U278784 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279254 [Download] [View] Facility Assigned ID: STMHF36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5