EST details — SGN-E427182

Search information 
Request: 427182Match: SGN-E427182
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276793Clone name: STM-47-N14
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276793 [STM-47-N14] Trace: SGN-T279318 EST: SGN-E427181 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427182Length: 406 bp (869 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427182 [] (trimmed) TATTAAAACAAATAGAGATACTACATTCACGTCTCACCATCATCATTGATTAAAAAAATAAAAATTTAAATGTTTTGTCTAAGAAAAATTTATTA
GACCTGAATATATTATCATCTACTAGGTACTATTCTTCTACACTCCTCCAAACGACACCCGAAGTCTCTTATCTAAAATGACCGACATGGAAATC
TGACAAGTTGACTCTTAAAATTTGACACAAAATAAGAACTTAAACAACTAGAATAACAAATATTTGAATTTAAGACACTAGTATTACACAAATAT
TTAACTTATTAATTCTCTCTGATTATTATCAACTTAATAATAAAACATAATCATTTTTCTGGCAACTTCCCTGTTGAATAACCAGAGAACTGGGA
TTATTTTTGTGGGATATTTATTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427182] SGN-U271053 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279319 [Download] [View] Facility Assigned ID: STMHF79TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.901 Expected Error Rate: 0.0069 Quality Trim Threshold: 20.5