EST details — SGN-E427224

Search information 
Request: 427224Match: SGN-E427224
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276891Clone name: STM-48-C3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276891 [STM-48-C3] Trace: SGN-T279360 EST: SGN-E427223 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427224Length: 393 bp (1073 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427224 [] (trimmed) TTTCCTATCTAATATGTCTCTTTAACATAACGAAACAAGATGAAACAGAGGATAAAAATTACAAAGGTAAACAGAAATCAAGAAACAAAGAAGGT
AGTTAAACAGAGTGGAGTAGGTTTATTGGAGAAGTACAGAGGCATAAGGAAAAAGAAGTTGCCAAGCTATATGGCAGGTGTTTGTGTAACTGTAT
TTTTGACTAAGGAGAGGGTTTTTTATTTTGCAGAGATGAAGAAGTGGAAGCTGGAGGAACACCAGGAAAACCAGGTATGATCGGTGGGAAAAGTG
GAGGGAGAGGTGGGAAGAGTGAAGGGGGCGGTGGTGGGGGAGATGGAGTTAAACCANGTATGAGTGGTGGGATAAACGGAGGGAATAATGAAGGT
GGAAAACGTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427224] SGN-U273666 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279361 [Download] [View] Facility Assigned ID: STMHG14TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0130 Quality Trim Threshold: 20.5