EST details — SGN-E427247

Search information 
Request: 427247Match: SGN-E427247
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276931Clone name: STM-48-E23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427247Length: 668 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E427247 [] (trimmed) TCTATCTATTATTATACATATATAAACATTATCTTGCCATAGAATTAAGCCCTTAAACATAAATGGGAGAACTAGAAGTTAATTACAAGGAAGTT
CCTTCTGTCCAGGAGCTGGCCAAGAAGAAACTCGTGACGATTCCATCGCGATATGTACGTGATGATCATGACAATTCATCAATCGCATCAAATGA
TCGTAATAATAAGGAAGTTCCAGTCATTGACATGCAACGATTGGTCATTTCTAATGATCATGACATCATGAATCTCGAGCTTAACAAGTTGCATT
TTGCAGCTCAACACTGGGGTTTCTTTCAGTTGATTAATCATGGAGTTAGTTCTTCCGTGGTGGAGAAGATGAAACACGAGACTCAAAAGTTCTAC
GATCTTCCATTAGAAGAGAAGAAGAAATTTGAACGATCACCGCGCGATGCAGATGGATTTGGACAGCTGTTCGTTGTCTCTGATGAACAAAAACT
TGACTGGGCAGACCTTTTTTATTTGAAGACCGCACCTCCACATTTGCGGATGCCTATATTTTCCAAGCTATACCTTTCACTTAGAGAGACGATTG
AAGAGTACACGGAAGAAATAAAGGAGCTAAGCATGAAAGTTTTGGAAATGTTGGGTAAAGCTTTGGGGATTAAAGAAAAAGAAGTGAAGAGTCTT
TTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427247] SGN-U275103 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279384 [Download] [View] Facility Assigned ID: STMHG36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5