Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E427293

Search information 
Request: 427293Match: SGN-E427293
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277096Clone name: STM-48-M3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277096 [STM-48-M3] Trace: SGN-T279429 EST: SGN-E427292 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427293Length: 873 bp (1086 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427293 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTNNNNTTAAAGAAAGAGTACAATTCACCACTGGGTTTTCTTAAAACTCATGCATAAGAATCAACAGTTTAC
ATAACTCCTTTGCTAACATGCAACTAAGTATTTGAAGTAAAAGAGCTAATCATCCTGCTTCAAAAAAAATTACCTGCAATAAAGGAAAATTCATG
AGACATTAGTGTGATCACATAAAATGTGCAAATTATCAACAACAATAATAATATAATCAATGTAATTCTATAAGTGAGTTTGGAGAAAGTGGTGT
GTACGTTTATACCATACCCCTGCCTTGTGAAGGAAAAGAGGATGTTTTGATAGACCTCCGGCTCAAAAATAAATAGGTAAAACAAATGTAGTGGC
TAAGAAGTCATGTTGAAAACAATGAAGAGAATAGTAGCAATGACAAAATAATATGACAACTAGAATAAGATGCTAAATTATTAATTACCGGTAAG
AAAAAAGCATATATAAATTTACAAATATCTTGACAGTAGCCTAAGCCTTTTTTTTGTTGTTAACTATGTCCACCAAGGCTTGGACAAATGGAAAC
AAATCATCTAATATTTTTGCCTCTACTAGGATTTGAACTCGAGACCTCATGGGTTTTAACCACTTCATTGACCGCTAGGCCATACCTTGGGTACT
TTTCATGAACCTAAACCTTGGTGGTTAAAGTTACGCAGGTGAAATAATCGAAATAGTCAATTAATAATTACAAATATGCCTTGTTTTCTTGGCTT
GCTGCAAGAAGAAAAGGGAAAAGATTGTTCAAATTATGTGACCATTTCATCAAAAACTTAAAACTCTAAGAAAGCGTACACTTTTGTTTACTTAA
AATTAGTGTTCATCATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427293] SGN-U277587 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279430 [Download] [View] Facility Assigned ID: STMHG74TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0146 Quality Trim Threshold: 20.5