EST details — SGN-E427387

Search information 
Request: 427387Match: SGN-E427387
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277009Clone name: STM-48-I16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277009 [STM-48-I16] Trace: SGN-T279525 EST: SGN-E427388 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427387Length: 629 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E427387 [] (trimmed) CTCTCACCACACCTCCTCCGTCTCTCCACCACCGGCTCCACACGTTCCTCTCCCTCTCTTCCCCCTTCGTTGAAACCCTAAGCACCCCACCGCCT
GCATTGTCCGGAACCACCGAGACCACCCCGCTCCCTCTCCTCTTCTTTAACAGAAGCCTTCTCCGACGGGGACACTCCAAGAATGAGGCTCGAGA
GGGTTGTTGGTCGAGTTCCATAACTTCACCTGTTTCTCTGTTAAGCTTCGAGGTTTCGATTTCTCAAATTCATCCCAGGTAATTAATTATATTTT
AATTTCAAGACTCAAGGGTGTGAAGCCGGCGTTGGAAACAACAACTTTATTCAAAGGTGTTCTTAAGGCAGGAAAAGAATAATGGGTGCTGTTAA
ACTGCAACTTCCGTTGCCTAAAAGTGTTGATGGAGTCACCCTGGATCCAAATCCTGATTGGACCTTTGATGCTTTATTGGTTGAGCTCAATTCGA
TTGAGAAGAAGCTCAATGCATCATCAAAATTTCCAATACCTTTTACGAAAACAGAATCGCGACAACTCTCGGCTTCAAAGGATAATTCTCGGAGA
GGCTTTGNTATGNCAGTGTCTGATGATGACGTGGAGGATATGGACAGAGATACTAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427387] SGN-U282450 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279524 [Download] [View] Facility Assigned ID: STMHH56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.993 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5